ftsH [2020-01-26 11:54:15]

ATP-dependent metalloprotease

Locus: BSU_00690

Isoelectric point: 5.84

Molecular weight: 70.76 kDa

Protein length: 637 aa

Gene length: 1914 bp

Function: cell division, sporulation initiation

Product: ATP-dependent metalloprotease

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → Other genes
• Information processing → Protein synthesis, modification and degradation → Proteolysis → Additional proteins involved in proteolysis
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Regulation
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Lifestyles → Coping with stress → Heat shock proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 76,984 78,897

Phenotypes of a mutant

• defective in biofilm formation PubMed
• strongly reduced sporulation frequency PubMed, PubMed

The protein

Catalyzed reaction/ biological activity

• degrades Spo0E and Spo0M, resulting in reduced sporulation frequency in a ftsH mutant PubMed
• FtsH is involved in the degradation of EzrA PubMed
• degrades SpoIIE PubMed

Protein family

• central section: AAA ATPase family (according to UniProt)
• C-terminal section: Peptidase M41 family (single member, according to UniProt)

Paralogous protein(s)

• YjoB

Effectors of protein activity

• protease activity is controlled by the interaction with the flottilins FloA and FloT PubMed

Structure

• 1LV7 (from E. coli, 64% identity) PubMed

Localization

• cell membrane PubMed
• preferentially at the division septum PubMed
• forms some foci in the membrane PubMed

Expression and Regulation

Operons

• Genes: tilS-hprT-ftsH
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • TilS: activation, with HprT PubMed, in TilS regulon
  • HprT: activation, with TilS PubMed, in HprT regulon

  Regulation

  • induced by heat shock (class III)

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

• Genes: spoIIE-yabS-yabT-tilS-hprT-ftsH
  Description: PubMed

  Sigma factors

  • SigF: sigma factor, PubMed, in SigF regulon

  Regulation

  • expressed early during sporulation in the forespore (SigF) PubMed

• Genes: ftsH
  Description: PubMed

  Regulation

  • induced by heat shock (class III)

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

• GP2640 (ftsH::aphA3), available in Jörg Stülke's lab
• MGNA-A084 (ftsH::erm), available at the NBRP B. subtilis, Japan
• 1A1061 ( ftsH::cat), PubMed, available at BGSC
• 1A1060 ( ftsH::erm), PubMed, available at BGSC
• BKE00690 (ftsH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCCTTACCTCCTCCCAC, downstream forward: _UP4_TAATTCGCTTTCTTTCTAAA
• BKK00690 (ftsH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCCTTACCTCCTCCCAC, downstream forward: _UP4_TAATTCGCTTTCTTTCTAAA

References

Reviews

Loading

Original publications

Loading